Mercurial > repos > estrain > metaspades

changeset 0:292d633441ad draft default tip

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload commit c251e9b174b5370300a209b2b4c5e2052976eb2d
author estrain
date Fri, 13 Mar 2026 12:07:47 +0000
parents
children
files metaspades.xml test-data/corona_scaffold.fasta write_tsv_script.py
diffstat 3 files changed, 255 insertions(+), 0 deletions(-) [+]
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/metaspades.xml	Fri Mar 13 12:07:47 2026 +0000
@@ -0,0 +1,221 @@
+<tool id="metaspades" name="metaSPAdes" version="3.15.5+galaxy1.01" profile="20.01">
+    <description>metagenome assembler (minimal; interlaced / R1+R2 / paired collection; maps list:paired)</description>
+
+    <requirements>
+            <requirement type="package" version="4.2.0">spades</requirement>
+            
+    </requirements>
+
+    <stdio>
+        <exit_code range="1:" level="fatal"/>
+    </stdio>
+
+    <version_command><![CDATA[
+metaspades.py --version
+    ]]></version_command>
+
+    <command detect_errors="exit_code"><![CDATA[
+## ---------------------------------
+## Prep short-read inputs / symlinks
+## ---------------------------------
+#set $library = 1
+
+#if str($singlePaired.sPaired) == "paired_interlaced"
+    mkdir -p reads1 &&
+    #set $ext = $singlePaired.input1.ext.replace('fastqsanger','fastq').replace('fastqillumina','fastq')
+    ln -s '$singlePaired.input1' 'reads1/interlaced_1.${ext}' &&
+#end if
+
+#if str($singlePaired.sPaired) == "paired_two_files"
+    mkdir -p paired_reads1 &&
+    #set $ext1 = $singlePaired.input1.ext.replace('fastqsanger','fastq').replace('fastqillumina','fastq')
+    #set $ext2 = $singlePaired.input2.ext.replace('fastqsanger','fastq').replace('fastqillumina','fastq')
+    ln -s '$singlePaired.input1' 'paired_reads1/reads_1.${ext1}' &&
+    ln -s '$singlePaired.input2' 'paired_reads1/reads_2.${ext2}' &&
+#end if
+
+#if str($singlePaired.sPaired) == "paired_collection"
+    mkdir -p paired_reads1 &&
+    #set $extc = $singlePaired.input.forward.ext.replace('fastqsanger','fastq').replace('fastqillumina','fastq')
+    ln -s '$singlePaired.input.forward' 'paired_reads1/reads_1.${extc}' &&
+    ln -s '$singlePaired.input.reverse' 'paired_reads1/reads_2.${extc}' &&
+#end if
+
+## ---------------------------------
+## Optional long-read inputs / links
+## ---------------------------------
+#set $nano_paths = []
+#if $longreads.nanopore and len($longreads.nanopore) > 0
+    mkdir -p lr_nanopore &&
+    #for $lri, $lr in enumerate($longreads.nanopore)
+        #set $link = 'lr_nanopore/nano_%s.%s' % ($lri, $lr.ext)
+        ln -s '$lr' '$link' &&
+        $nano_paths.append($link)
+    #end for
+#end if
+
+#set $pbhifi_paths = []
+#if $longreads.pacbio_hifi and len($longreads.pacbio_hifi) > 0
+    mkdir -p lr_pbhifi &&
+    #for $lri, $lr in enumerate($longreads.pacbio_hifi)
+        #set $link2 = 'lr_pbhifi/pbhifi_%s.%s' % ($lri, $lr.ext)
+        ln -s '$lr' '$link2' &&
+        $pbhifi_paths.append($link2)
+    #end for
+#end if
+
+#set $nano_joined = ' '.join(["'%s'" % p for p in $nano_paths]) if $nano_paths else ''
+#set $pbhifi_joined = ' '.join(["'%s'" % p for p in $pbhifi_paths]) if $pbhifi_paths else ''
+
+## ----------
+## Run SPAdes
+## ----------
+metaspades.py 
+    -o 'output' 
+    -t \${GALAXY_SLOTS:-4} 
+#if $resources.ram_gb
+    -m ${resources.ram_gb} 
+#end if
+## short-read layout
+#if str($singlePaired.sPaired) == "paired_interlaced"
+    --${singlePaired.type_paired}-12 ${library} 'reads1/interlaced_1.${ext}'
+    --${singlePaired.type_paired}-or ${library} ${singlePaired.orientation}
+#elif str($singlePaired.sPaired) == "paired_two_files"
+    --${singlePaired.type_paired}-1  ${library} 'paired_reads1/reads_1.${ext1}'
+    --${singlePaired.type_paired}-2  ${library} 'paired_reads1/reads_2.${ext2}'
+    --${singlePaired.type_paired}-or ${library} ${singlePaired.orientation}
+#else
+    ## paired_collection (and list:paired maps to this one pair per job)
+    --${singlePaired.type_paired}-1  ${library} 'paired_reads1/reads_1.${extc}'
+    --${singlePaired.type_paired}-2  ${library} 'paired_reads1/reads_2.${extc}'
+    --${singlePaired.type_paired}-or ${library} ${singlePaired.orientation}
+#end if
+## long-reads
+#if $nano_paths
+    --nanopore ${nano_joined}
+#end if
+#if $pbhifi_paths
+    --pacbio-hifi ${pbhifi_joined}
+#end if
+## chemistry / pipeline flags
+#if $pipeline.iontorrent
+    --iontorrent
+#end if
+#if $pipeline.phred and str($pipeline.phred) != ''
+    --phred-offset ${pipeline.phred}
+#end if
+#if $pipeline.kmers and str($pipeline.kmers) != ''
+    -k '${pipeline.kmers}'
+#end if
+    ]]></command>
+
+    <inputs>
+        <!-- Short-read entry points -->
+        <conditional name="singlePaired" label="Short-read layout">
+            <param name="sPaired" type="select" label="Reads are">
+                <option value="paired_interlaced">Interlaced paired reads (single FASTQ)</option>
+                <option value="paired_two_files">Paired-end reads in two files (R1/R2, not a collection)</option>
+                <option value="paired_collection">Paired-end reads as a paired collection</option>
+            </param>
+
+            <!-- (1) Interlaced -->
+            <when value="paired_interlaced">
+                <param name="input1" type="data" format="fastqsanger,fastqsanger.gz,fastq,fastq.gz"
+                       label="Interlaced FASTQ"/>
+                <param name="type_paired" type="select" label="Library type">
+                    <option value="pe" selected="true">Paired-end (--pe-*)</option>
+                    <option value="hqmp">High-quality mate-pairs (--hqmp-*)</option>
+                    <option value="mp">Mate-pairs (--mp-*)</option>
+                </param>
+                <param name="orientation" type="select" label="Orientation (--*-or)">
+                    <option value="fr" selected="true">fr (forward-reverse)</option>
+                    <option value="rf">rf (reverse-forward)</option>
+                    <option value="ff">ff (forward-forward)</option>
+                </param>
+            </when>
+
+            <!-- (2) Two files (R1/R2) -->
+            <when value="paired_two_files">
+                <param name="input1" type="data" format="fastqsanger,fastqsanger.gz,fastq,fastq.gz"
+                       label="Forward (R1) FASTQ"/>
+                <param name="input2" type="data" format="fastqsanger,fastqsanger.gz,fastq,fastq.gz"
+                       label="Reverse (R2) FASTQ"/>
+                <param name="type_paired" type="select" label="Library type">
+                    <option value="pe" selected="true">Paired-end (--pe-*)</option>
+                    <option value="hqmp">High-quality mate-pairs (--hqmp-*)</option>
+                    <option value="mp">Mate-pairs (--mp-*)</option>
+                </param>
+                <param name="orientation" type="select" label="Orientation (--*-or)">
+                    <option value="fr" selected="true">fr (forward-reverse)</option>
+                    <option value="rf">rf (reverse-forward)</option>
+                    <option value="ff">ff (forward-forward)</option>
+                </param>
+            </when>
+
+            <!-- (3) Paired collection (maps list:paired automatically) -->
+            <when value="paired_collection">
+                <param name="input" type="data_collection" collection_type="paired"
+                       label="Paired collection (forward/reverse). To run one job per pair from a list:paired, map the list to this input."/>
+                <param name="type_paired" type="select" label="Library type">
+                    <option value="pe" selected="true">Paired-end (--pe-*)</option>
+                    <option value="hqmp">High-quality mate-pairs (--hqmp-*)</option>
+                    <option value="mp">Mate-pairs (--mp-*)</option>
+                </param>
+                <param name="orientation" type="select" label="Orientation (--*-or)">
+                    <option value="fr" selected="true">fr (forward-reverse)</option>
+                    <option value="rf">rf (reverse-forward)</option>
+                    <option value="ff" >ff (forward-forward)</option>
+                </param>
+            </when>
+        </conditional>
+
+        <!-- Optional long-reads -->
+        <section name="longreads" title="Optional long-read data">
+            <param name="nanopore" type="data" multiple="true"
+                   format="fastq,fastq.gz,fastqsanger,fastqsanger.gz,fasta,fasta.gz"
+                   optional="true" label="Nanopore reads (--nanopore)"/>
+            <param name="pacbio_hifi" type="data" multiple="true"
+                   format="fastq,fastq.gz,fastqsanger,fastqsanger.gz,fasta,fasta.gz"
+                   optional="true" label="PacBio HiFi reads (--pacbio-hifi)"/>
+        </section>
+
+        <!-- Simple knobs -->
+        <section name="resources" title="Resources">
+            <param name="ram_gb" type="integer" value="16" min="1"
+                   label="Max RAM for SPAdes (-m, in GB)"/>
+        </section>
+
+        <section name="pipeline" title="Chemistry and pipeline options">
+            <param name="iontorrent" type="boolean" truevalue="true" falsevalue=""
+                   checked="false" label="IonTorrent data (--iontorrent)"/>
+            <param name="phred" type="select" optional="true" label="Phred offset (--phred-offset)">
+                <option value="" selected="true">auto (default)</option>
+                <option value="33">33</option>
+                <option value="64">64</option>
+            </param>
+            <param name="kmers" type="text" optional="true"
+                   label="K-mer sizes (-k)" help="Comma-separated odd integers between 21 and 127, e.g. 21,33,55"/>
+        </section>
+    </inputs>
+
+    <outputs>
+        <data name="out_cn" format="fasta" from_work_dir="output/contigs.fasta"
+              label="metaSPAdes on ${on_string}: contigs"/>
+        <data name="out_sc" format="fasta" from_work_dir="output/scaffolds.fasta"
+              label="metaSPAdes on ${on_string}: scaffolds"/>
+        <data name="out_ag" format="fasta" from_work_dir="output/assembly_graph.fastg"
+              label="metaSPAdes on ${on_string}: assembly graph (FASTG)"/>
+        <data name="out_ags" format="gfa1" from_work_dir="output/assembly_graph_with_scaffolds.gfa"
+              label="metaSPAdes on ${on_string}: assembly graph with scaffolds (GFA)"/>
+        <data name="out_l" format="txt" from_work_dir="output/spades.log"
+              label="metaSPAdes on ${on_string}: log"/>
+    </outputs>
+
+    <help><![CDATA[
+]]></help>
+
+    <citations>
+        <citation type="doi">10.1101/gr.213959.116</citation>
+    </citations>
+</tool>
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/corona_scaffold.fasta	Fri Mar 13 12:07:47 2026 +0000
@@ -0,0 +1,18 @@
+>NODE_1_length_1009_cluster_1_candidate_1_domains_2
+GTTCAAGCTGAGGCAAAACGCCTTTTTCAACTTCTACTAAGCCACAAGTGCCATCTTTAG
+GATGTTGACGTGCCTCTGATAAGACCGCCTCCACTGGAGGATACACAGGTTTAAAGGTTT
+ATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAAC
+GAACTTTAAAATCTGTGTGGCTGTCACTCGGCTGCATGCTTAGTGCACTCACGCAGTATA
+ATTAATAACTAATTACTGTCGTTGACAGGACACGAGTAACTCGTCTATCTTCTGCAGGCT
+GCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTTCGTCCGGGTGT
+GACCGAAAGGTAAGATGGAGAGCCTTGTCCCTGGTTTCAACGAGAAAACACACGTCCAAC
+TCAGTTTGCCTGTTTTACAGGTTCGCGACGTGCTCGTACGTGGCTTTGGAGACTCCGTGG
+AGGAGGTCTTATCAGAGGCACGTCAACATCTTAAAGATGGCACTTGTGGCTTAGTAGAAG
+TTGAAAAAGGCGTTTTGCCTCAACTTGAACAGCCCTATGTGTTCATCAAACGTTCGGATG
+CTCGAACTGCACCTCATGGTCATGTTATGGTTGAGCTGGTAGCAGAACTCGAAGGCATTC
+AGTACGGTCGTAGTGGTGAGACACTTGGTGTCCTTGTCCCTCATGTGGGCGAAATACCAG
+TGGCTTACCGCAAGGTTCTTCTTCGTAAGAACGGTAATAAAGGAGCTGGTGGCCATAGTT
+ACGGCGCCGATCTAAAGTCATTTGACTTAGGCGACGAGCTTGGCACTGATCCTTATGAAG
+ATTTAAGATGGCACTTGTGGCTTAGTAGAAGTTGAAAAAGGCGTTTTGCCTCAACTTGAA
+CAGCCCTATGTGTTCATCAAACGTTCGGATGCTCGAACTGCACCTCCTGGTCATGTTGAG
+CTGGTAGCAGAACTCGAAGGCATTCAGTACGGTCGTAGTGGTGAGACAC
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/write_tsv_script.py	Fri Mar 13 12:07:47 2026 +0000
@@ -0,0 +1,16 @@
+#!/usr/bin/env python
+
+import re
+import sys
+
+search_str = r"^>(NODE|\S+)_(\d+)(?:_|\s)length_(\d+)_cov_(\d+\.*\d*)(.*\$)?"
+
+replace_str = r"\1_\2\t\3\t\4"
+
+cmd = re.compile(search_str)
+
+sys.stdout.write("#name\tlength\tcoverage\n")
+
+for i, line in enumerate(sys.stdin):
+    if cmd.match(line):
+        sys.stdout.write(cmd.sub(replace_str, line))